Sgd Tools¶
Configuration File: sgd_tools.json
Tool Type: Local
Tools Count: 8
This page contains all tools defined in the sgd_tools.json configuration file.
Available Tools¶
SGD_get_disease_annotations (Type: SGDTool)¶
Get curated gene-disease (Disease Ontology / DOID) associations for a yeast gene from SGD, inferr…
SGD_get_disease_annotations tool specification
Tool Information:
Name:
SGD_get_disease_annotationsType:
SGDToolDescription: Get curated gene-disease (Disease Ontology / DOID) associations for a yeast gene from SGD, inferred by orthology to human genes. Returns disease name, DOID, annotation type, evidence, and references. Example: S000000364 (CDC28) is associated with ‘cancer’ (DOID:162), manually curated.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000000364’ (CDC28), ‘S000000259’ (GAL4).
Example Usage:
query = {
"name": "SGD_get_disease_annotations",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_get_gene (Type: SGDTool)¶
Get yeast gene/locus overview from SGD (Saccharomyces Genome Database) by SGD identifier. Returns…
SGD_get_gene tool specification
Tool Information:
Name:
SGD_get_geneType:
SGDToolDescription: Get yeast gene/locus overview from SGD (Saccharomyces Genome Database) by SGD identifier. Returns gene name, systematic name, description, UniProt ID, aliases, and functional annotations. S. cerevisiae is the primary model organism for eukaryotic cell biology. Example: S000000259 returns GAL4, the galactose metabolism transcription factor.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000000259’ (GAL4), ‘S000003219’ (RMR1), ‘S000005564’ (ACT1).
Example Usage:
query = {
"name": "SGD_get_gene",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_get_go_annotations (Type: SGDTool)¶
Get Gene Ontology annotations for a yeast gene from SGD. Returns GO terms (biological process, mo…
SGD_get_go_annotations tool specification
Tool Information:
Name:
SGD_get_go_annotationsType:
SGDToolDescription: Get Gene Ontology annotations for a yeast gene from SGD. Returns GO terms (biological process, molecular function, cellular component), evidence codes, qualifiers, and references. SGD GO annotations are among the most thoroughly curated in any model organism. Example: S000003219 (RMR1) has annotations for meiotic recombination and cytoplasm localization.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000003219’ (RMR1), ‘S000005564’ (ACT1), ‘S000000259’ (GAL4).
Example Usage:
query = {
"name": "SGD_get_go_annotations",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_get_interactions (Type: SGDTool)¶
Get genetic and physical interactions for a yeast gene from SGD. Returns interaction type (Physic…
SGD_get_interactions tool specification
Tool Information:
Name:
SGD_get_interactionsType:
SGDToolDescription: Get genetic and physical interactions for a yeast gene from SGD. Returns interaction type (Physical/Genetic), experiment type (Two-hybrid, Affinity Capture-MS, Synthetic Lethality, etc.), interacting gene names, and references. Yeast interaction data is the most comprehensive of any organism. Example: S000003219 (RMR1) has 178 interactions.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000003219’ (RMR1), ‘S000005564’ (ACT1), ‘S000000259’ (GAL4).
Example Usage:
query = {
"name": "SGD_get_interactions",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_get_phenotypes (Type: SGDTool)¶
Get curated phenotype annotations for a yeast gene from SGD. Returns observable phenotypes (growt…
SGD_get_phenotypes tool specification
Tool Information:
Name:
SGD_get_phenotypesType:
SGDToolDescription: Get curated phenotype annotations for a yeast gene from SGD. Returns observable phenotypes (growth, morphology, fitness), mutant types, experimental methods, strain backgrounds, and chemical conditions. Yeast phenotypes are a key resource for functional genomics. Example: S000003219 (RMR1) has 29 phenotype annotations including competitive fitness, respiratory growth defects.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000003219’ (RMR1), ‘S000000259’ (GAL4), ‘S000005564’ (ACT1).
Example Usage:
query = {
"name": "SGD_get_phenotypes",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_get_regulation (Type: SGDTool)¶
Get the transcriptional regulation network for a yeast gene from SGD: curated regulator->target r…
SGD_get_regulation tool specification
Tool Information:
Name:
SGD_get_regulationType:
SGDToolDescription: Get the transcriptional regulation network for a yeast gene from SGD: curated regulator->target relationships with evidence, direction, and references. Returns pairs where the queried gene is regulator or target. Example: S000000364 (CDC28) is regulated by IXR1 (S000001515) with ‘DNA to cDNA expression microarray evidence’, regulation_of=transcription.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000000364’ (CDC28), ‘S000000259’ (GAL4).
Example Usage:
query = {
"name": "SGD_get_regulation",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_get_sequence (Type: SGDTool)¶
Get genomic, coding, and protein sequences plus genomic coordinates for a yeast gene from SGD (re…
SGD_get_sequence tool specification
Tool Information:
Name:
SGD_get_sequenceType:
SGDToolDescription: Get genomic, coding, and protein sequences plus genomic coordinates for a yeast gene from SGD (reference strain S288C). Returns the genomic DNA start/end/strand and full residue strings for genomic_dna, coding_dna, and protein. Example: S000000364 (CDC28) returns genomic_dna start=560078 end=560974 with residues ‘ATGAGCGGTGAATTAGCAAAT…’.
Parameters:
sgd_id(string) (required) SGD locus identifier. Examples: ‘S000000364’ (CDC28), ‘S000005564’ (ACT1).
Example Usage:
query = {
"name": "SGD_get_sequence",
"arguments": {
"sgd_id": "example_value"
}
}
result = tu.run(query)
SGD_search (Type: SGDTool)¶
Search SGD across all data types (genes, GO terms, phenotypes, references, alleles, diseases, com…
SGD_search tool specification
Tool Information:
Name:
SGD_searchType:
SGDToolDescription: Search SGD across all data types (genes, GO terms, phenotypes, references, alleles, diseases, complexes, pathways). Returns matching entries with categories, descriptions, and links. Supports category filtering. Example: searching ‘GAL4’ finds the transcription factor gene, related references, alleles, and GO terms.
Parameters:
query(string) (required) Search query string. Examples: ‘GAL4’, ‘cell cycle’, ‘sporulation’.category(string) (optional) Filter by category. Options: ‘locus’, ‘reference’, ‘biological_process’, ‘molecular_function’, ‘cellular_component’, ‘phenotype’, ‘disease’, ‘allele’, ‘complex’, ‘pathway’, ‘chemical’, ‘strain’, ‘download’.limit(integer) (optional) Maximum results to return (default 10, max 50).offset(integer) (optional) Pagination offset (default 0).
Example Usage:
query = {
"name": "SGD_search",
"arguments": {
"query": "example_value"
}
}
result = tu.run(query)