Sgd Tools#

Configuration File: sgd_tools.json Tool Type: Local Tools Count: 8

This page contains all tools defined in the sgd_tools.json configuration file.

Available Tools#

SGD_get_disease_annotations (Type: SGDTool)#

Get and page through curated gene-disease (Disease Ontology / DOID) associations for a yeast gene…

SGD_get_disease_annotations tool specification

Tool Information:

  • Name: SGD_get_disease_annotations

  • Type: SGDTool

  • Description: Get and page through curated gene-disease (Disease Ontology / DOID) associations for a yeast gene from SGD. Returns true total/continuation metadata plus disease, qualifier, annotation source, and reference fields.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000000364’ (CDC28), ‘S000000259’ (GAL4).

  • limit (integer) (optional) Maximum disease annotations to return.

  • offset (integer) (optional) Zero-based disease annotation offset.

Example Usage:

query = {
    "name": "SGD_get_disease_annotations",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_get_gene (Type: SGDTool)#

Get a yeast gene/locus overview from SGD. Returns gene identifiers, descriptions, qualities, and …

SGD_get_gene tool specification

Tool Information:

  • Name: SGD_get_gene

  • Type: SGDTool

  • Description: Get a yeast gene/locus overview from SGD. Returns gene identifiers, descriptions, qualities, and explicitly pageable aliases with the true alias total and next offset; broad cross-resource alias lists are not silently stopped at 10.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000000259’ (GAL4), ‘S000003219’ (RMR1), ‘S000005564’ (ACT1).

  • alias_limit (integer) (optional) Maximum aliases to return on this page.

  • alias_offset (integer) (optional) Zero-based offset into all locus aliases.

Example Usage:

query = {
    "name": "SGD_get_gene",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_get_go_annotations (Type: SGDTool)#

Get and page through Gene Ontology annotations for a yeast gene from SGD. Returns the true total …

SGD_get_go_annotations tool specification

Tool Information:

  • Name: SGD_get_go_annotations

  • Type: SGDTool

  • Description: Get and page through Gene Ontology annotations for a yeast gene from SGD. Returns the true total and next offset plus GO aspect, evidence code, qualifier, annotation type, source, and reference.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000003219’ (RMR1), ‘S000005564’ (ACT1), ‘S000000259’ (GAL4).

  • limit (integer) (optional) Maximum GO annotations to return.

  • offset (integer) (optional) Zero-based GO annotation offset.

Example Usage:

query = {
    "name": "SGD_get_go_annotations",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_get_interactions (Type: SGDTool)#

Get and page through genetic and physical interactions for a yeast gene from SGD. Returns true to…

SGD_get_interactions tool specification

Tool Information:

  • Name: SGD_get_interactions

  • Type: SGDTool

  • Description: Get and page through genetic and physical interactions for a yeast gene from SGD. Returns true total/continuation metadata plus interaction and experiment types, partner identifiers, annotation source, and reference; large networks do not silently stop at 50.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000003219’ (RMR1), ‘S000005564’ (ACT1), ‘S000000259’ (GAL4).

  • limit (integer) (optional) Maximum interactions to return.

  • offset (integer) (optional) Zero-based interaction offset.

Example Usage:

query = {
    "name": "SGD_get_interactions",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_get_phenotypes (Type: SGDTool)#

Get and page through curated phenotype annotations for a yeast gene from SGD. Returns the true to…

SGD_get_phenotypes tool specification

Tool Information:

  • Name: SGD_get_phenotypes

  • Type: SGDTool

  • Description: Get and page through curated phenotype annotations for a yeast gene from SGD. Returns the true total, returned count, and next offset plus observable phenotype, mutant, experiment, strain, allele, chemical, and reference fields.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000003219’ (RMR1), ‘S000000259’ (GAL4), ‘S000005564’ (ACT1).

  • limit (integer) (optional) Maximum phenotype annotations to return.

  • offset (integer) (optional) Zero-based phenotype annotation offset.

Example Usage:

query = {
    "name": "SGD_get_phenotypes",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_get_regulation (Type: SGDTool)#

Get and page through the transcriptional regulation network for a yeast gene from SGD. Returns tr…

SGD_get_regulation tool specification

Tool Information:

  • Name: SGD_get_regulation

  • Type: SGDTool

  • Description: Get and page through the transcriptional regulation network for a yeast gene from SGD. Returns true total/continuation metadata plus regulator-target identifiers, evidence, direction, biological context, and references; dense networks do not silently stop at 100.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000000364’ (CDC28), ‘S000000259’ (GAL4).

  • limit (integer) (optional) Maximum regulation records to return.

  • offset (integer) (optional) Zero-based regulation-record offset.

Example Usage:

query = {
    "name": "SGD_get_regulation",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_get_sequence (Type: SGDTool)#

Get genomic, coding, and protein sequences plus genomic coordinates for a yeast gene from SGD (re…

SGD_get_sequence tool specification

Tool Information:

  • Name: SGD_get_sequence

  • Type: SGDTool

  • Description: Get genomic, coding, and protein sequences plus genomic coordinates for a yeast gene from SGD (reference strain S288C). Returns the genomic DNA start/end/strand and full residue strings for genomic_dna, coding_dna, and protein. Example: S000000364 (CDC28) returns genomic_dna start=560078 end=560974 with residues ‘ATGAGCGGTGAATTAGCAAAT…’.

Parameters:

  • sgd_id (string) (required) SGD locus identifier. Examples: ‘S000000364’ (CDC28), ‘S000005564’ (ACT1).

Example Usage:

query = {
    "name": "SGD_get_sequence",
    "arguments": {
        "sgd_id": "example_value"
    }
}
result = tu.run(query)

SGD_search (Type: SGDTool)#

Search SGD across genes, GO terms, phenotypes, references, alleles, diseases, complexes, pathways…

SGD_search tool specification

Tool Information:

  • Name: SGD_search

  • Type: SGDTool

  • Description: Search SGD across genes, GO terms, phenotypes, references, alleles, diseases, complexes, pathways, and other indexed categories. The query is applied through SGD’s q parameter. Returns complete descriptions with description_length and explicit offset pagination; while has_more is true, use next_offset in the next call.

Parameters:

  • query (string) (required) Search query string. Examples: ‘GAL4’, ‘cell cycle’, ‘sporulation’.

  • category (string) (optional) Filter by category. Options: ‘locus’, ‘reference’, ‘biological_process’, ‘molecular_function’, ‘cellular_component’, ‘phenotype’, ‘disease’, ‘allele’, ‘complex’, ‘pathway’, ‘chemical’, ‘strain’, ‘download’.

  • limit (integer) (optional) Number of results per page (default 10, max 50).

  • offset (integer) (optional) Zero-based pagination offset; use next_offset for the following page.

Example Usage:

query = {
    "name": "SGD_search",
    "arguments": {
        "query": "example_value"
    }
}
result = tu.run(query)