Idt Tools¶
Configuration File: idt_tools.json
Tool Type: Local
Tools Count: 2
This page contains all tools defined in the idt_tools.json configuration file.
Available Tools¶
IDT_analyze_oligo (Type: IDTTool)¶
Analyze an oligonucleotide using the IDT OligoAnalyzer API. Calculates melting temperature (Tm), …
IDT_analyze_oligo tool specification
Tool Information:
Name:
IDT_analyze_oligoType:
IDTToolDescription: Analyze an oligonucleotide using the IDT OligoAnalyzer API. Calculates melting temperature (Tm), GC content, molecular weight, molar extinction coefficient, and nmol/OD260 and ug/OD260 yields. Tm is calculated using nearest-neighbor thermodynamic parameters (SantaLucia 1998) under user-specified salt conditions (Na+, Mg2+, dNTPs). Supports DNA and RNA oligos up to 200 bases. Use this BEFORE ordering primers/probes to verify Tm, check GC balance, and estimate synthesis yields. Complements NEB_Tm_calculate (which provides polymerase-specific Tm with salt corrections) and DNA_calculate_gc_content (local, no Tm). For self-dimer/homodimer assessment, use IDT_check_self_dimer.
Parameters:
sequence(string) (required) Oligonucleotide sequence (5’ to 3’). Must contain only A, T, C, G (DNA) or A, U, C, G (RNA) bases. Length: 5-200 bases. Example: ‘AGCGGATAACAATTTCACACAGGA’na_concentration_mm([‘number’, ‘null’]) (optional) Sodium (Na+) concentration in millimolar (mM). Affects Tm calculation. Typical range: 0-1000 mM. Default: 50 mM. Standard PCR buffer is ~50 mM.mg_concentration_mm([‘number’, ‘null’]) (optional) Magnesium (Mg2+) concentration in millimolar (mM). Stabilizes duplexes, raising Tm. Typical range: 0-20 mM. Default: 0 mM. Standard PCR uses 1.5-3.0 mM.dntps_concentration_mm([‘number’, ‘null’]) (optional) dNTPs concentration in millimolar (mM). dNTPs chelate Mg2+, reducing effective Mg2+. Typical range: 0-10 mM. Default: 0 mM. Standard PCR uses 0.2-0.8 mM.oligo_concentration_um([‘number’, ‘null’]) (optional) Oligo concentration in micromolar (uM). Affects Tm slightly. Default: 0.25 uM.oligo_type([‘string’, ‘null’]) (optional) Type of oligonucleotide: ‘DNA’ or ‘RNA’. Default: ‘DNA’.
Example Usage:
query = {
"name": "IDT_analyze_oligo",
"arguments": {
"sequence": "example_value"
}
}
result = tu.run(query)
IDT_check_self_dimer (Type: IDTTool)¶
Check an oligonucleotide for self-complementarity and homodimer (self-dimer) formation using the …
IDT_check_self_dimer tool specification
Tool Information:
Name:
IDT_check_self_dimerType:
IDTToolDescription: Check an oligonucleotide for self-complementarity and homodimer (self-dimer) formation using the IDT OligoAnalyzer API. Returns predicted self-dimer structures with their thermodynamic stability (delta-G in kcal/mol), number of base pairs, and alignment diagrams. A more negative delta-G indicates a more stable (problematic) dimer. Risk assessment: delta-G > -3.0 kcal/mol is low risk, -3.0 to -6.0 is moderate risk, < -6.0 is high risk. Use this tool AFTER designing primers (DNA_primer_design or manual) and BEFORE ordering, to verify primers won’t form stable homodimers that reduce PCR efficiency. For basic oligo properties (Tm, GC%, MW), use IDT_analyze_oligo instead.
Parameters:
sequence(string) (required) Oligonucleotide sequence (5’ to 3’). Must contain only A, T, C, G, U bases. Length: 5-200 bases. Example: ‘AGCGGATAACAATTTCACACAGGA’na_concentration_mm([‘number’, ‘null’]) (optional) Sodium (Na+) concentration in millimolar (mM). Affects dimer stability. Default: 50 mM.mg_concentration_mm([‘number’, ‘null’]) (optional) Magnesium (Mg2+) concentration in millimolar (mM). Default: 0 mM.temperature_celsius([‘number’, ‘null’]) (optional) Temperature in Celsius for dimer stability calculation. Use your expected annealing temperature. Default: 25.
Example Usage:
query = {
"name": "IDT_check_self_dimer",
"arguments": {
"sequence": "example_value"
}
}
result = tu.run(query)